Ntbbf1arrolb
Web30 jan. 2024 · As a control, free GFP (pTF486) was transiently expressed in tomato protoplasts. Fluorescence was examined with a confocal laser scanning microscope …
Ntbbf1arrolb
Did you know?
WebIn the promoter of the WUS gene of Arabidopsis and its two orthologs in Populus trichocarpa (PopWUS1 and PopWUS2) various auxin sensitive elements were detected: AuxRE, … Web4 mei 2015 · Notably, seven auxin-responsive cis-elements (NTBBF1ARROLB and AUXREPSIAA4)/auxin response factor-binding sites (ARFAT) and 11 nodulin consensus …
Web9 okt. 2014 · -2801 ggctggtttctaagacattttttggtttaatccaaacctaattacaa atatt cccaacaa rootmotiftapox1 -2741 gatcgaatgatctatggctacaaaccctatcccaacaaaaaactacatttagtacatcaa -2681 ... WebShaded rows indicate that putative cis-regulatory elements were detected in all 3 promoters. cis Element Sequence Number of Elements GmActin GmRpS11 GmHsp90 1 2 0 Predicted Function -10 promoter element, light -10PEHVPSBD TATTCT regulation and circadian rhythms, chloroplast gene 2SSEEDPROTBANAPA CAAACAC 0 1 0 …
Web16 feb. 2024 · Among the enriched CAREs, four (NTBBF1ARROLB, SORLIP5AT, ANAC_C3b and E2FCONSENSUS) were unique to a given subnetwork, and two (RVE1–2 and LECPLEACS2) were only co-enriched in the VviATL89 (VIT ... Web10 nov. 2024 · We chose to focus on three auxin response elements: the AuxRR-core (GGTCCAT), TGA-element (AACGAC), and ntBBF1ARROLB (named BBF) (ACTTTA), …
Web1 jun. 2009 · We describe the development of a reporter system for monitoring meristem initiation in poplar using promoters of poplar homologs to the meristem-active regulatory genes WUSCHEL ( WUS ) and SHOOTMERISTEMLESS ( STM ). When ~3 kb of the 5′ flanking regions of close homologs were used to drive expression of the GUSPlus gene, …
Web9 nov. 2024 · Main conclusion Several cis-elements including Myb-binding motifs together confer glandular trichome specificity as revealed from heterologous expression and … perkinelmer chemoffice suiteWeb14 jul. 2024 · Our analysis of osa-miR167 members also found that auxin-responsive CREs (ARFAT, ASF1MOTIFCAMV, CATATGGMSAUR, NTBBF1ARROLB and … perkinelmer chemoffice professionalWeb2 okt. 2012 · ntbbf1arrolb site 177 (+) acttta s000273 OSE1ROOTNODULE site 659 (+) AAAGAT S000467 OSE2ROOTNODULE site 249 (+) CTCTT S000468 perkinelmer chemdraw professional 16Web21 sep. 2024 · Background Transgenic technology has become an important technique for crop genetic improvement. The application of well-characterized promoters is essential for developing a vector system for efficient genetic transformation. Therefore, isolation and functional validation of more alternative constitutive promoters to the CaMV35S … perkinelmer chemdraw professional 16.0WebGenerate, customise, save, share, gift, print, browse & love word cloud art with WordItOut, the free word cloud maker online since 2010. perkinelmer chemoffice suite 2018Web16 apr. 2015 · Furthermore, the SlARF9 promoter sequence contains several NTBBF1ARROLB-elements. These elements were first identified in the promoter sequence of rolB , one of the oncogenes present in the T-DNA sequence of Agrobacterium rhizogenes , and are involved in the auxin-inducible expression of the rolB -gene in plants ( … perkinelmer coa searchWeb12 mrt. 2012 · NTBBF1ARROLB: 10: Required for tissue-specific expression and auxin induction; Agrobacterium rhizogenes: SEBFCONSSTPR10A: 3: Similar to the auxin … perkinelmer chemoffice suite 2021 v21.0.0.28